Если вы что то не нашли, прошу вас воспользоваться поиском по сайту. Поиск работает отлично.

2

Иформация для животноводов




« Научные библиотеки интернета  | В начало |  проявления патологии родов »


ВЫДЕЛЕНИЕ РНК ВИРУСА ВИРУСНОЙ ДИАРЕИ КРУПНОГО РОГАТОГО СКОТА

27.02.13 21:10

РОССИЙСКАЯ АКАДЕМИЯ СЕЛЬСКОХОЗЯЙСТВЕННЫХ НАУК

СИБИРСКОЕ ОТДЕЛЕНИЕ

ГОСУДАРСТВЕННОЕ НАУЧНОЕ УЧРЕЖДЕНИЕ

ИНСТИТУТ ЭКСПЕРИМЕНТАЛЬНОЙ ВЕТЕРИНАРИИ

СИБИРИ И ДАЛЬНЕГО ВОСТОКА

 

ВЫДЕЛЕНИЕ РНК ВИРУСА ВИРУСНОЙ ДИАРЕИ КРУПНОГО РОГАТОГО СКОТА

И ИНДИКАЦИЯ МЕТОДОМ НОЗЕРН-БЛОТ ГИБРИДИЗАЦИИ

 

МЕТОДИЧЕСКИЕ РЕКОМЕНДАЦИИ    НОВОСИБИРСК - 2002

 

УДК 579.252.55:615.332:579.25:577.212.3

2002.- 14 с.

Вирус вирусной диареи крупного рогатого скота (ВД КРС) - возбудитель инфекционного заболевания парнокопытных животных, при котором поражаются слизистые оболочки, возникают аборты, развивается выраженная иммунодепрессия. Для разработки ОТ-ПЦР, РНК-ДНК гибридизации, а так же для создания систем по экпрессии гена необходимы чистые нативные препараты геномной РНК вируса без примеси клеточной ДНК.

Выявление геномной РНК вируса вирусной диареи крупного рогатого скота методом молекулярной гибридизации и, в частности, Нозерн-блот гибридизации требует изготовления биотинилированного ДНК-зонда.

В рекомендациях дано описание получения препаратов геномной РНК вируса и изготовления биотинилированного ДНК-зонда.

Данные рекомендации рассчитаны на сотрудников НИУ.

Методические рекомендации подготовили: канд. вет. наук

В.И.Семенихин, С.А. Юрик, В.Н. Афонюшкин (ГНУ ИЭВСиДВ).

Рекомендации рассмотрены и утверждены Ученым советом ГНУ ИЭВСиДВ СО РАСХН (протокол N 6 от 16 октября 2002 г.) и подсекцией "Инфекционная патология животных в регионе Сибири и Дальнего Востока" Отделения ветеринарной медицины Россельхозакадемии (протокол N 2 от 21 октября 2002 г.).

Рецензент: д-р вет. наук А.Г. Глотов.

ВВЕДЕНИЕ

Вирусная диарея крупного рогатого скота (ВД КРС, BVDV) является вирусным заболеванием, встречающимся в естественных условиях среди всех парнокопытных животных: молодняка крупного рогатого скота, овец, оленей и косуль (Dufell S.J., Harkness J.W.1985). Заболевание протекает с развитием респираторного или диарейного синдрома. В патогенезе этой болезни характерным моментом является блокирование иммунореактивности организма вследствие поражения иммунокомпетентных клеток. Под действием такого влияния этот вирус может быть потенциальной причиной или усиливать патогенность коинфицирующих микроорганизмов: вируса парагриппа-3, вируса инфекционного ринотрахеита КРС, коронаротавирусов, Pasteurella spp, Salmonella spp, coccidia (Roth J.A.,Kaeberie M.L.1983). Вирус также оказывает негативное воздействие на воспроизводительную функцию коров.

В настоящее время основным способом диагностики данного заболевания является метод реакции нейтрализации на культуре клеток при исследовании сыворотки крови на наличие антител, применяя принцип парных сывороток, взятых с интервалом 3-4 недели. Следует отметить, что метод вирусовыделения на культуре клеток обладает высокой трудоемкостью, не позволяет выявить нецитопатогенные штаммы, а серологическая диагностика недостаточно чувствительна в связи с иммунодепрессивным действием вируса и наличием иммунотолерантных животных, что затрудняет постановку диагноза - вирусная диарея (Roth J.A.,Kaeberie M.L. 1983).

Разрабатываемые новые методы диагностики (блот РНК-ДНК гибридизация, РНК-ДНК гибридизация in situ, обратная транскрипция in situ) данного заболевания основаны на выявлении геномной РНК ВД КРС и, соответственно, требуют ее выделения в чистом, нативном состоянии из различных биологических образцов (культура клеток МДБК, сгустки крови, селезенка, печень от больных и подозреваемых в вирусоносительстве животных) (Hames B.D., HigginsS.J.1985;Phatt B., McGee J.D.,1990; Innis M.A., Gelfand D.H., Sninscy J.J., White T.J. 1982).

Следует учесть, что плазмидные и фаговые ДНК зонды обладают недостаточной специфичностью в связи с наличием гетерогенной векторной последовательности ( Hawhey P.M., Lewys D.A., 1989). Отличительной чертой Нозерн-блот гибридизации является то, что получаемый зонд является, в отличие от ранее созданных (Brounlie J., Booth P.J. Stevens D.A.1997.), ПЦР-зондом и не содержит векторной последовательности. Степень биотинилированности зонда регулируется в ходе его синтеза и может достигать 20% биотинилированных оснований. ПЦР-система, рассчитанная для синтеза зонда, является уникальной и создана для работы только с цитопатогенными штаммами, что уменьшает риск наработки зонда с матрицы контаминирующего штамма. Обратная транскрипция производится с использованием ревертазной Tth-DNA-полимеразы, что позволило добиться специфичности отжига праймеров уже на этапе обратной транскрипции. Методика изготовления зонда позволяет синтезировать как двух, так и одноцепочечные зонды. Это позволяет добиться высокой чувствительности, специфичности и воспроизводимости реакции.

ПОЛУЧЕНИЕ ВИРУСА ВИРУСНОЙ ДИАРЕИ

КРУПНОГО РОГАТОГО СКОТА

В своей работе мы использовали перевиваемую культуру клеток МДВК. Культивирование клеток, заражение их вакцинным штаммом вируса ВК-1 (ВИЭВ) и Oregon C24 V осуществляли согласно "Методическим указаниям по лабораторной диагностике вирусных респираторных, кишечных инфекций крупного рогатого скота". Клетки выращивали в стационарных условиях в 500 мл флаконах, используя среду Игла МЕМ с глютамином и добавлением 3-4% сыворотки крупного рогатого скота при индексе пересева 1:2. После образования монослоя клетки заражали вакцинным штаммом ВК-1 (ВИЭВ) и Орегон С24 V.

ВЫДЕЛЕНИЕ ГЕНОМНОЙ РНК ВИРУСА ВИРУСНОЙ ДИАРЕИ КРУПНОГО РОГАТОГО СКОТА

Для выделения геномной РНК вируса ВД КРС из зараженных культур клеток можно использовать различные методы. Одним из них является гуанидин-фенольный. Сущность его сводится к следующему. Осадок зараженных клеток обрабатывается лизирующим раствором: 6 М гуанидинизотиоционат, 0,1 М цитрат натрия, 0,5% саркозил, 0,1 М бетта- меркаптоэтанол. Затем лизат клеток экстрагируется равным объемом фенола при плавном перемешивании 1-2 мин. Далее к экстракту добавляется равный объем хлороформа и центрифугируется 10 мин при 14000 об/мин. Водная фаза переносится в другую пробирку и вновь экстрагируется полуторным объемом фенола и хлороформа (1:1) в течение 1-2 мин. После центрифугирования водная фаза переносится в другую пробирку и снова экстрагируется фенолом и хлороформом. Повторяется эта процедура 3 раза. Затем из водной фазы РНК переосадается этанолом: к одному объему экстракта добавляется 2,5 объема этанола 960 и 1/10 общего объема ацетата натрия 3 М рН 5,2 и выдерживается при -20оС в течение 18 ч. Осадок растворяется в воде, еще раз переосаждается этанолом и наносится на 1,0% агарозный гель. При просмотре пластины геля видно, что препарат РНК, выделенный данным многоступеньчатым методом, не позволяет получить чистый препарат РНК, т.е. полностью освободиться от клеточной ДНК. В процессе работы обратили внимание на то, что результаты не всегда воспроизводимы. Поэтому с учетом исследований, проведенных P. Chomczinski and N. Sacchi (1987) мы изменили соотношение компонентов раствора. Увеличили концентрацию цитрата натрия до 0,42 М, саркозила до 0,85%, а бетта-меркаптоэтанола уменьшили до 0,2 mМ.

Выделение геномной РНК вируса ВД КРС из культуры клеток MDBK

При выделении нативной, пригодной для генно-инженерных исследований, РНК из зараженной вирусом культуры клеток МДБК за основу был взят гуанидинтиоционат - фенол-хлороформенный метод. Зараженная культура клеток МДБК инкубируется при +37оС до 80% ЦПД вируса. После чего охлаждается до +5оС и оставшиеся на стекле клетки снимаются путем встряхивания. Вируссодержащая суспензия в объеме 400 мл осаждается в бляшку центрифугированием на центрифуге Т23D в бакет-роторе при 6000 об/мин. в течение 15-20 минут. Супернатант удаляется, а к осадку клеток добавляется 1 мл 4 М гуанидинтиоционата приготовленного на растворе, содержащем: 0,42 М цитрата натрия, 0,85% саркозила и 0,2 mM бетта-меркаптоэтанола. Плавно пипитируется и оставляется на 10-15 мин при комнатной температуре. Затем 500-700 мкл гомогената переносится в пробирку на 1,5 мл и добавляется: 50-70 мкл 3 М ацетата натрия pH 5,0; 300-400 мкл водонасыщенного фенола; 300-400 мкл хлороформа с изоамиловым спиртом (25:1). Содержимое пробирки перемешивается и выдерживается 20 минут при -10-15оС. Далее центрифугируется 10 минут при 14000 об/мин в центрифуге типа MPW-310. Водная фаза переносится в другую пробирку, добавляется изопропиловый спирт в равном объеме и оставляется на 2 часа при -20оС. Потом проба центрифугируется 15 минут при 14000 об/мин. Осадок растворяется в 300 мкл 4 М гуанидинтиоционата, добавляется 1/10 объема 3 М натрия ацетата pH 5,0 и 2,5 объема охлажденного этанола и помещается при -20оС на 2 часа или на ночь. После центрифугируется 15 минут при 14000 об/мин. Спирт удаляется, а осадки промываются в 100-150 мкл 70% этанола. Проба высушивается при +42-56оС и растворяется в 30-50 мкл бидистиллированной воды, обработанной 0,1% ДЕПК, или в TE буфере pH 7,5 (10 mM трис-HCL pH 7,4, 1 mM ЭДТА pH 8,0).

Данный метод превосходит предыдущий по многим параметрам. В частности, некоторые операции совмещены. Время, которое затрачивается на выделение вирусной РНК из зараженной культуры клеток равно 5,5-6,0 часов. Но самое большое значение имеет то, что в данном случае можно получать препарат РНК без примеси клеточной ДНК. Имеющаяся небольшая примесь рибосомальных РНК не мешает проводить синтезы первой цепочки комплементарной ДНК. В ряде случаев эту примесь рРНК можно использовать как рассеянную затравку.

Выделение геномной РНК вируса ВД КРС из патологического материала

Примерно к 300 мг патологического материала (селезенка, сгусток крови или др.) добавляется около 500 мг стеклопеска и растирается в ступке до однородной массы. К полученной суспензии приливается 1000 мкл денатурирующего раствора, состоящего из 4 М гуанидинтиоционата, 42 мМ цитрата натрия, 0,85% саркозила, 0,2 мМ бетта-меркаптоэтанола, перемешивается и оставляется на 15-20 минут при комнатной температуре.

500 мкл гомогената переносится в пробирку на 1,5 мл и добавляется 50 мкл 3 М ацетата натрия pH 5,0, 300 мкл водонасыщенного фенола, 300 мкл хлороформа с изоамиловым спиртом (49:1). Содержимое пробирки перемешивается и выдерживается 20 минут при -5 -10оС

Затем центрифугируется 10 минут при 14000 об/мин. Водная фаза переносится в другую пробирку и добавляется изопропиловый спирт в равном объеме и оставляется на 2 часа при -20оС.

Проба центрифугируется 15 минут при 14000 об/мин. Осадок растворяется в 300 мкл 4 М гуанидинтиоционата, добавляется 30 мкл 3 М натрия ацетата pH 5,0 и 750 мкл охлажденного этанола и помещается на ночь при -20оС или на 5 мин в жидкий азот.

Центрифугируется 15 минут при 14000 об/мин. Спирт удаляется, а осадки промываются в 100 мкл 70% этанола. Затем высушиваются при +56оС и растворяются в 15-20 мкл бидистиллированной воды или TE буфера pH 7,5 (10 mM трисHCl pH 7,4; 1mM ЭДТА pH 8,0).

Выделение геномной РНК вируса ВД КРС из сухой вирусвакцины

Во флакон с сухой инактивированной вакциной вносится 2000- 3000 мкл денатурирующего раствора, состоящего из 4 М гуанидинтиоционата, 42 мМ цитрата натрия, 0,85% саркозила, 0,2 мМ бетта-меркаптоэтанола, перемешивается и оставляется на 15-20 минут при комнатной температуре (+20-22оС).

Полученный лизат переносится в полипропиленовую пробирку и добавляется 200-300 мкл 3 М ацетата натрия рН 5,0, по 1800 мкл водонасыщенного фенола и хлороформа с изоамиловым спиртом (49:1) и помещается на -5-10оС на 20 минут.

Центрифугируется в угловом роторе центрифуги Т23D 15 минут при 8000 об/мин. К 4000 мкл водной фазы добавляется 2000 мкл водонасыщенного фенола и 2000 мкл хлороформа и вновь центрифугируется 15 минут при 8000 об/мин.

К водной фазе добавляется такой же объем охлажденного изопропилового спирта и пробирки с содержимым помещаются на 1,5-2 часа при -20оС или на

-45оС на 40 минут, или в жидкий азот на 5 минут. Затем центрифугируются 15 минут при 8000 об/мин. Изопропанол тщательно удаляется.

Осадок растворяется в 300 мкл денатурирующего раствора, вносится 30 мкл 3 М ацетата натрия рН 5,0 и 1000 мкл охлажденного этанола и помещается на 2 часа при -20оС, или на 1 час при -45оС, или на 5 минут в жидкий азот. В случае необходимости можно оставить пробы в спирте при -20оС на ночь.

Центрифугируется 15 минут при 14000 об/мин. Спирт удаляется, а осадки промываются в 100-150 мкл 70% этанола. Спирт удаляется, осадки высушиваются при +56оС и растворяются в 40-80 мкл бидистиллированной воды, обработанной 0,1% DEPC или TE буфера pH 7,5.

Оценка выделенной геномной РНК

Предварительная оценка выделенной РНК вируса ВД КРС проводится с помощью электрофореза в 1% геле агарозы с использованием трис-боратной буферной системы. По 5-10 мкл полученных препаратов РНК смешивается с 3-5 мкл раствора, содержащего 50%-ный глицерин и бромфеноловый синий, и вносятся в "карман" геля. Контролем служил препарат суммарной РНК, выделенный из незараженной вирусом ВД КРС культуры клеток MDBK. После электрофореза гель окрашивается бромистым этидием (0,5 мкг/мл) и просматривается под УФ-светом через красный светофильтр.

ИЗГОТОВЛЕНИЕ И ИСПЫТАНИЕ ДНК-ЗОНДА

Синтез кДНК с помощью реакции обратной транскрипции

Температура отжига праймера при использовании ревертазного буфера, разработанного в нашей лаборатории, составляет 54оС. Эта температура является оптимальной для ревертазной активности ферментаTth-полимеразы, поэтому удается добиться высокоспецифичной гибридизации ревертазного праймера на РНК-матрице вируса. В то время как другие ревертазы работают при температурах не выше 40оС, что приводит к неспецифической гибридизации праймеров во многих местах как РНК вируса, так и посторонней РНК. Помимо этого высокая температура ревертазной реакции позволяет сократить время ее проведения с 1.5 до 0.5 часов.

Перед постановкой реакции обратной транскрипции (ОТ) в объеме 12,5 мкл. готовится реакционная смесь: 5х ревертазный буфер для Тth-полимеразы 2,5мкл 2.5мМ; dNTP 1,3 мкл праймер ОТ №1 серии bvhc 5OU/ml 0,5 мкл; DEPC Н2О 5,2; мкл мRNA 2,5 мкл. Tth-полимераза 0,5мкл.

Последовательность праймера для обратной транскрипции: bvhc1up (5233-5257) GATCATGCCTAGAGGGACTACACC.

После добавления РНК вируса вирусной диареи реакционная смесь инкубируется при 54 оС в течение 30 мин.

Синтез и биотинилирование ДНК-зонда

Данная реакция является специализированной ПЦР рассчитанной и сконструированной специально для синтеза ДНК зонда, праймеры являются уникальными последовательностями, рассчитанными для гибридизации с цитопатогенными штаммами вируса вирусной диареи 1-го и 2-го типов. Биотинилированные основания могут вводится в реакционную смесь в разных соотношениях с небиотинилированными, что позволяет регулировать интенсивность включения метки в зонд. Последовательности праймеров имеют участки, которые могут быть модифицированы в некоторые сайты рестрикции без изменения чувствительности и специфичности праймеров. Данная реакция может быть проведена в режиме ассиметричной ПЦР с тем же буфером и по тому же температурному режиму при использовании праймеров 24-35 в молярном соотношении 25:1 на стадии включения метки.

Перед постановкой полимеразной цепной реакции (ПЦР) в объеме 25 мкл. готовится реакционная смесь: 10х буфер для Таq-DNA-полимеразы 2,5мкл 2.5мМ; dNTP 2,0 мкл праймеры ПЦР№№ 24up и 35low серии bvhc 5OU/ml 2,5 мкл; Н2О 12,5 мкл; kDNA 5,0 мкл.

Реакцию необходимо проводить по следующей программе: Первый блок - реассоциация 90оС 1мин, отжиг праймеров 53оС 1 мин. синтез ДНК 70оС 1,5 мин. количество циклов 30. Второй блок - завершение синтеза 73оС 4 мин.

Последовательности праймеров для ПЦР:

bvhc24up (5709 - 5733) AGTCCAAACCCACAAAGATAATGA

bvhc35low (6154- 6133) AATAATTGCCAGTTGTTCAGG

Мечение фрагмента осуществляется путем введения в реакционную смесь 1.0 мМ Био-dNTU 1,0 мкл. и проведения дополнительно 10 циклов ПЦР по той же программе.

Методы контроля технологии изготовления зонда.

Реакции ОТ и ПЦР рассчитаны для индикации вируса вирусной диареи. В обеих реакциях температурные режимы оптимальны для специфичного отжига праймеров. Необходимым условием проведения мечения ПЦР продукта является его электрофоретическая разгонка в 1% геле агарозы и выявление полосы, соответствющей 450 п.н.(Маниатис Т.с соавт. 1984; Ausubel F.M., Moore D.D.,et al. 1987.) В качестве маркера молекулярного веса оптимально использование плазмиды pQPR, обработанной рестриктазой НАЕ III. Специфичность и чувствительность зонда контролируется путем моллекулярной гибридизации на мембранном фильтре (Нозерн-блот) с вирусной РНК штаммов Oregon C24 и ВК-1 ВИЭВ а также с заведомо отрицательными контролями - РНК и ДНК крупного рогатого скота (Hames B.D., Higgins S.J. 1985; Giri I., Danos O. 1986).

Постановка реакции Нозерн-блот гибридизации.

Пробы, выделенные по стандарнтной методике (см. выше), наносят на капроновый фильтр.

Нанесение образцов РНК на фильтры для гибридизации.

После осаждения РНК в пробах к осадкам добавляют по 10 мкл раствора 2хSSC (1xSC-0,15M NaCl, 0,015M Na-цитрат рН 7,2) На фильтры наносят по 1 мкл каждой пробы и контрольных РНК (поставляются в наборе). Фильтры подсушивают на воздухе, затем промывают 2 мин в растворе 5хSSC, снова подсушивают и облучают ультрафиолетовой лампой в течение 1 минуты. Фильтры с нанесенными пробами можно хранить до гибридизации в холодильнике при 5оС в течение 2-х недель.

Гибридизация образцов РНК с биотинилированным ДНК-зондом. Предгибридизация. Фильтр с иммобилизированной РНК помещают в кювету с гибридизационным раствором (5 мл) и инкубируют 1 час при 65оС. Гибридизационный раствор: 6хSSC, 5х Денхардт, 0,5% SDS, денатурированнная ДНК лосося в концентрации 0,1 мг/мл, 10% формамида (поставляется в наборе).

Гибридизация. К 5 мл гибридизационного раствора добавляют 10 мкл биотинилированного ДНК зонда, смесь переносят в кювету для гибридизации и помещают туда фильтр. Ведут гибридизацию в течение 3 час при 59оС.

Выявление биотиновых групп на фильтре с помощью коньюгата стрептавидина с щелочной фосфатазой и красителей.

Блокирующий буфер Б: 0,1 М трис НСl pH 7,5, 0,1 M NaCl, 3 mM MgCl2, 0,5% твин-20 Реакционный буфер Р: 0,1 М трис НСl pH 7,5, 0,1 M NaCl, 3 mM MgCl2, 0,05% твин-20 АР-буфер: 0,1 М трис-HCl pH 9,5, 0,1 M NaCl, 5mM MgCl2. 4.2 Отмывка от биотинилированного зонда. После гибридизации сливают раствор зонда (его можно использовать повторно), фильтр предварительно промывают 15 мин при комнатной температуре, затем 15 минут при температуре 60оС в растворе 1хSSC, 0,1% SDS, потом еще 15 минут при температуре 60оС в растворе 0,2хSSC,0,1% SDS.

Блокирование фона. Перед обработкой коньюгатом стрептавидина с щелочной фосфатазой фильтр выдерживают в блокирующем буфере Б в течение 30 минут при комнатной температуре для предотвращения неспецифического связывания коньюгата с фоновой поверхностью фильтра.

Обработка коньюгатом. После стадии блокирования фильтр замачивают на 5 мин в реакционном буфере Р, затем, промокнув фильтровальной бумагой, переносят на чистый лист лавсана. Наносят на фильтр коньюгат стрептавидина с фосфатазой , предварительно разбавив его реакционным буфером в 1000 раз (1 мкл коньюгата до 1мл реакционным буфером). На фильтр размером 5х5 см необходимо 2 мл разбавленного коньюгата. Накрывают фильтр вторым листом лавсана, убирают пузырьки воздуха между листами и оставляют на 20-30 минут. Отмывка от коньюгата Отмывают фильтр от избытка коньюгата 3 раза по 5 минут блокирующим буфером Б и один раз АР-буфером.

Окрашивание. Красители для фосфатазы растворяют в диметилформамиде (2,5 мг 5-бром 3-индолил-фосфата в 50 мкл ДМФА, 4 мг нитротетразолевого синего в 50 мкл ДМФА) и переносят в пробирку с АР-буфером (15 мл) Фильтр заливают раствором красителей и оставляют в темноте до появления окрашенных пятен (обычно от 1 до 5 часов при комнатной температуре или 30-60 минут при температуре 37оС). После окрашивания фильтр промывают дистиллированной водой и высушивают.

Результаты гибридизации оценивают визуально, сравнивая интенсивность окрашенных пятен для исследуемых образцов и контрольных РНК (положительные и отрицательные контроли).

Изучение чувствительности и специфичности реакции.

Полученный ДНК зонд гибридизируется: с мРНК 2-х референтных штаммов вируса вирусной диареи (Оregon C24 V и ВК-1 (ВИЭВ)), РНК, выделенной из селезенок серопозитивных в РН животных, также положительных в ОТ-ПЦР.

Обработка РНК ферментом РНКазой предотвращает появление гибридизационного сигнала, что свидетельствует об участии РНК в гибридизации.

Для подтверждения специфичности реакции ставятся отрицательные контроли с ДНК: аденовируса, вируса герпеса 1-го типа, 2-х штаммов E.Coli, 4-х видов рода Mycoplasma, полевых изолятов микроорганизмов родов Streptococcus, Staphilococcus, Fusobacterium, Proteus, хромосомной ДНК кролика и коровы, РНК из проб селезенки крупного рогатого скота отрицательного при исследовании методом ОТ-ПЦР и серонегативного при исследовании сыворотки крови с помощью реакции нейтрализации.Во всех случаях, реакция должна быть отрицательной Учитывая тот факт, что синтез нуклеиновых кислот идет в направлении DNA - RNA, можно сделать вывод - использование хромосомной DNA при оценке специфичности Нозерн-блот-гибридизации дает гарантию отсутствия в клетках комплементарной зонду гетерогенной иРНК, при экспрессии любого хромосомного гена.

Оценка чувствительности реакции производится путем нанесения десятикратных разведений РНК вируса вирусной диареи и проведения Нозерн-блот гибридизации (см. табл.1). Перед проведением исследования определяется инфекционная активность вируса вирусной диареи (штамм Oregon C24 V) по методике Рида и Менча.

Чувствительность является наибольшей при использовании ПЦР-зонда, разведенного в 500 раз. Дальнейшее увеличение концентрации зонда приводит к повышению фоновой окраски.

Таблица 1

Оценка чувствительности Нозерн-блот-гибридизации

Доза вируса, ТЦД50

10000

1000

100

10

1

0,1

0,01

0,001

Реакция

+

+

+

+

+

+

+

-

Примечание:"+" - положительная реакция,"-" - отрицательная реакция.

Из таблицы 1, видно, что чувствительность зонда превосходит чувствительность культуры клеток на 2 порядка (равна 0,01 ТЦД50), при этом следует учесть, что вирус в дозе 1 ТЦД50 проявляет цитопатогеннное действие до 7 суток инкубации.

Использование молекулярной гибридизации для диагностики вирусной диареи.

Реакцию Нозерн-блот гибридизации можно использовать как дополнение к серологической диагностике (см. табл.2 ). В этом случае, во-первых, появляется возможность установить, при каких титрах антител возможно обнаружение геномной РНК вируса, что будет свидетельствовать о его репликации в организме. Во-вторых, встречаются ли среди серонегативных животных вирусоносители, что позволит говорить об иммунотолерантности данного животного.

 

 

 

 

Таблица 2

Результаты исследований проб, полученых от серопозитивных и

серонегативных животных.

№ пробы

Вид

Животного

материал

реакция нейтрализации

ДНК-РНК

гибридизация

1

2

3

4

5

6

7

КРС

КРС

КРС

КРС

КРС

КРС

КРС

селезенка

селезенка

селезенка

селезенка

селезенка

селезенка

селезенка

+

+

+

+

+

+

-

+

+

+

+

+

+

-

Другой вариант использования тест-системы - изучение животных с наличием клинических признаков, характерных для вирусной диареи крупного рогатого скота (см. табл. 3).

Таблица 3

Анализ материала от клинически здоровых и больных телят

в возрасте 5-6 мес.

№ пробы

Наличие

Клинических

Признаков

Материал

 

ДНК-РНК

гибридизация

1

2

3

4

5

6

Присутствуют

Присутствуют

Присутствуют

Отсутствуют

Отсутствуют

Отсутствуют

Кровь

Кровь

Кровь

Кровь

Кровь

Кровь

+

+

+

+

+

+

Из таблицы 3 следует, что в данном хозяйстве распространена и бессимптомная форма инфекции.

 

 

 

ЗAКЛЮЧЕНИЕ

При выделении геномной РНК ВД КРС из различных биологических образцов использовали гуанидинтиоционат-фенол-хлороформенный метод, в котором изменили соотношение компонентов лизирующего раствора (увеличили концентрацию цитрата натрия до 0,42 М, саркозила до 0,85%, а бета-меркаптоэтанола уменьшили до 0,2 mM), что позволило получать препарат РНК без примеси клеточной ДНК.

Амплифицированный и биотинилированный фрагмент генома вируса вирусной диареи крупного рогатого скота может быть использован в качестве ДНК-зонда в реакции Нозерн-блот-гибридизации с целью индикации генома вируса в биологических объектах. Исследования показывают его высокую чувствительность (до 10-2 ТЦД/50). Отсутствие векторной последовательности резко снижает вероятность неспецифической гибридизации зонда с нуклеиновыми кислотами посторонней микрофлоры, в первую очередь с фагами и плазмидами бактерий. Использование в качестве матрицы РНК вируса снижает рискизменения последовательности зонда, в то время как в рекомбинантных плазмидах нередко происходит выщепление фрагмента и повышенный уровень мутаций. Степень биотинилированности зонда регулируется в ходе его синтеза и может достигать 20% биотинилированных оснований. ПЦР-система, рассчитанная для синтеза зонда, является уникальной и создана для работы только с цитопатогенными штаммами, что уменьшает риск наработки зонда с матрицы контаминирующего штамма. Обратная транскрипция производится с использованием ревертазной Tth-DNA-полимеразы, что позволило добиться специфичности отжига праймеров уже на этапе обратной транскрипции. Методика изготовления зонда позволяет синтезировать как двух-, так и одноцепочечные зонды, что позволяет добиться высокой чувствительности, специфичности и воспроизводимости реакции.

 

 

 

 

 

 

ЛИТЕРАТУРА

1. Маниатис Т., Э.Фрич, Д.Сэмбрук. Гель-электрофорез//Молекулярное клонирование. - 1984. - С.157- 167.

2. Ausubel F.M., Brent R., Kingson R.E., Moore D.D., Current protocols in molecular biology. Join Wiley, NewYorK. 1987. p. 678

3. Hames B.D., Higgins S.J. Nucleic acids gibridization: Practical aproach. IRL press, Oxford. 1985 p.89-97

4. Giri I., Danos O. Trend in Genet. 1986 p.34

5. Innis M.A., Gelfand D.H., Sninscy J.J., White T.J. PCR protocols, a guide to metods and applycation. Academic press. California. 1982 p. 346

6. Hawhey P.M., Lewys D.A., Medical bacteryologi: a practical approach. IRL press. Oxford. 1989. p.124

7. Maniatis T., Frich E.F., Sambrook J. Mollecular cloning: a laboratory manual. Gold spring Harbor press. NY. 1982 p.443

8. Marmur J. A procedure for the isolation of deoxyribonucleic acid from microorganisms//J. Mol. Biol. - 1961.- Vol.3.-P.208-218.

9. Phatt B., McGee J.D., In situ gibridisation: Principles end practice. Oxford 1990 p.149

10. Сюрин В.Н., Белоусова Р.В., Фомина Н.В.//В кн.: Диагностика вирусных болезней животных.- Москва "Агропромиздат" 1991.- С. 366-371.

11. Семенихин В.И., Кругляк В.А. Выделение и очистка м-РНК вируса вирусной диареи крупного рогатого скота//Инфекционные болезни животных.Эпизоотология, диагностика, профилактика и меры борьбы: Сб.науч.тр./РАСХН. Сиб.отд-ние. ИЭВСиДВ.- Новосибирск, 1991.- С. 103-106.

12. Chomczinski P. and Sacchi N. Single-Step Method of RNA Isolation by Acid Guanidinium Thiocyanate-Phenol-Chloroform Extraction//Analyticol Biochemistry.- 1987.- N 162.- P. 156-159.

 

 

 

 

 

ВЫПИСКА

из протокола №2 от 21 октября 2002 г., заседания подсекции "Инфекционная патология животных в регионе Сибири и Дальнего Востока" отделения ветеринарной медицины Россельхозакадемии. Присутствовали: доктора ветеринарных наук: А.С.Донченко (председатель), П.Н. Смирнов, Н.А.Шкиль, С.К.Димов, С.И.Прудников, А.А. Самоловов (секретарь), В.В.Храмцов, А.М. Шадрин; кандидаты ветеринарных наук: Ю.Г. Юшков, Е.Ю.Смертина, Н.А.Донченко, О.А. Донченко.

Повестка: рассмотрение материалов методических рекомендаций "Выявление геномной РНК вируса вирусной диареи крупного рогатого скота методом Нозерн-блот гибридизации".

Автор:В.Н.Афонюшкин. Докладчик Афонюшкин кратко доложил материалы рекомендаций. Рецензент: Глотов А.Г. - зав. лабораторией биотехнологии, доктор ветеринарных наук. В настоящее время основным способом диагностики данного заболевания является метод реакции нейтрализации в культуре клеток при исследовании парных сывороток крови, взятых с интервалом 3-4 недели. Следует отметить, что метод вирусовыделения на культуре клеток обладает высокой трудоемкостью, не позволяет выявить нецитопатогенные штаммы, а серологическая диагностика - недостаточной чувствительна в связи с иммунодепрессивным действием вируса, что затрудняет постановку диагноза - вирусная диарея. Разрабатываемые новые методы диагностики ( блот РНК-ДНК гибридизация, РНК-ДНК гибридизация in situ, обратная транскрипция in situ) данного заболевания основаны на выявлении гнеомной РНК ВД КРС с помощью ДНК зонда. Предлагаемые методы диагностики, основанные на использовании генноинженерных методик (молекулярная гибридизация, ПЦР), являются перспективными и могут играть основную роль в постановке диагноза.

Авторы предлагают изготавливать зонд по разработанной методике. Данные рекомендации расcчитаны на научных сотрудников НИУ.

Постановили: Учитывая актуальность, новизну представленных материалов подсекция считает необходимым их утвердить. Председатель, член-корр. РАСХН А.С.Донченко Секретарь, д.в.н., А.А. Самоловов.





« Научные библиотеки интернета  | В начало |  проявления патологии родов »



  Когда Вы ищите информацию в интернете о КРС, вам нужно просматривать много сайтов о КРС А там между прочим больше 10 000 сайтов. Отсюда два вывода! 1-Запомнить эти 10 000 сайтов 2-Записать их в закладки и держать на виду Понятно что, чем сложнее задача, тем интересней её решать, но на всякий случай..... Добавь в закладки подпишись на сайт Животноводство КРС! Зарегистрируйся на сайте, и вы автоматически получите подписку о новостях на сайте, что бы быть в курсе. Спасибо что зашли на сайт!
 мои консультации
Не зарегистрирован
Войти через:
                                                                                                                                                                
 
 
Главная::Карта моего сайта::On-line Новости::Форум о КРС::Заболевания КРС::Ветеринар Крс::Консультации по КРС::Контакты
 

 
Яндекс.Метрика Тиц и pr сайта
LiveZilla Live Chat Software
ВебСтолица.РУ: создай свой бесплатный сайт!  | Пожаловаться  
Движок: Amiro CMS